alinalove6p5n1m7 alinalove6p5n1m7
  • 03-11-2018
  • English
contestada

what fact about hamlet would be most important to a student analyzing the play through a historical lens?

Respuesta :

adamsnappleseed adamsnappleseed
  • 03-11-2018

Probably the date in which it took place

Answer Link
roseebee99 roseebee99
  • 03-11-2018

The fact it took place during the Protestant Revolution, the time during which the idea of a heliocentric universe was being adopted, etc.

Answer Link

Otras preguntas

which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
four yardequal Blank feet
Please answer theses division problems!! 9 divided by 3/7
Fossils are most commonly found in which type of rock?
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
Fossils are most commonly found in which type of rock?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
what's the percentage of 1/8 ?