mi3tatehouse
mi3tatehouse mi3tatehouse
  • 04-04-2016
  • History
contestada

The United States drop the second atomic bomb in 1945 on the Japanese city of

Respuesta :

HistoryGuy HistoryGuy
  • 04-04-2016
The United States dropped the second atomic bomb in 1945 on the Japanese city of "Nagasaki" in Japan, which was highly controversial since many thought that the initial bomb would have been sufficient. 
Answer Link

Otras preguntas

Which of the following can be a cause of social change?
Toco el piano _______________ hace dos meses. desde se les por
Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability
what was considered an act of war in 1914?
The molarity of a solution that contains 0.50 moles of naoh in 200.0 milliliters of water is
Joseph and cleoma, who made the first cajun recording, were husband and wife
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What did Chinese traders exchange with Islamic merchants?
The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1
__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging