kiaunabeachovu10i kiaunabeachovu10i
  • 01-02-2019
  • Chemistry
contestada

why are people not able to scuba dive in the deep part of the ocean

Respuesta :

hallkayleel0lozgxtq
hallkayleel0lozgxtq hallkayleel0lozgxtq
  • 01-02-2019

It's very dangerous to go that deep into the ocean due to the water pressure and the coldness, no human can physically comprehend it, so if you do end up diving that deep into the ocean, you will suffocate, crush to death, or freeze very quickly.

Answer Link

Otras preguntas

Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
what is the most common type of vegetation throughout Latin America
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
How much money, in dollars, does one mole of nickels represent?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Which body tissue or organ contains the most mitochondria?