zaynabelali zaynabelali
  • 04-03-2020
  • History
contestada

What were the goals of the Economic Opportunity Act by President Johnson?

Respuesta :

careyhaley12
careyhaley12 careyhaley12
  • 08-03-2020

Answer:

authorized for information of local Community Action agencies as part of the war on poverty these agencies are directly all gated by the federal government it is the purpose of the Economic Opportunity Act to strengthen, supplement, and coordinate efforts in furtherance of that policy

Answer Link

Otras preguntas

who fought against each other in the crusades?
What would be the most likely effect of one company buying a competitor?
Please help me with this two step math problem! THANK YOU !!!!!!!!
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
2ln(5x)=8 solve for x