emmanuelayomide emmanuelayomide

01-09-2020
Mathematics

contestada

A farmland is 30cm long and 15cm wild what is the area of the farmland

Respuesta :

pragnaoli99 pragnaoli99

01-09-2020

Step-by-step explanation:

length(l)= 30cm

Breadth(b)=15cm

Area=l×b

=30×15

=450cm^2

Answer Link

tahainam65 tahainam65

01-09-2020

it is 30 then 15 cm long its mean 45 answer

Answer Link

Otras preguntas

N automóvil corre a 120 kilómetros por hora y otro a 80 kilómUetros por hora; si deben recorrer 960 kilómetros, ¿con cuántas horas de diferencia llega el primer

A towns population increased from 14523 to 16489 what is the percent increase in the towns population

Can u help me with the math problems plz ?

The only capital investment required for a small project is investment in inventory. The operating cash flow this year was $10,000, and inventory increased from

What kind of scientist would study the effects of acid rain on marble statues?

Which group suffered 6 million deaths in the holocaust

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Responding to an unforeseen threat that you either did not have a planned response for or has not been dealt with effectively by implementing your planned respo

There are 4 aces and 2 jokers in a standard deck of 52 cards. You pick one card at random. What is the probability of selecting an ace or a king. (Answer is in

f(x) = 3(x + 5)2 - 10