01-09-2020
Social Studies

contestada

How much land in the world does Asia cover? 1/4 2/3 1/3 1/2

Respuesta :

Nbr1wldr Nbr1wldr

01-09-2020

Answer:1/3 is the closest I can get.

Answer Link

Otras preguntas

Which are True or False ?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

20% of what number is equal to 2/3 of 90?

*The sum of two numbers is 400. If the first number is decreased by 20% and the second number is decreased by 15%, then the sum would be 68 less. Find the numbe

What law required Northerners to assist in the return of runaway slaves

Towards the end of Anne's diary, her entries stop being about her relationship with Peter and focuses more on what? the burglaries in the house the food

A circular swimming pool has a diameter of 12 feet. What is the circumference the pool? Use 3.14 to approximate for π . Enter your answer, as a decimal rou

You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis

Which of the following explains why an actual cost might differ from a projected cost? -The desired item goes on sale. -The item is no longer available and a re

I need help on exterior angles!