ambehern2292 ambehern2292

04-01-2021
Mathematics

contestada

Find the value of x.
m22 = 3x + 13
40°
N
X=

Respuesta :

amaanansariz8882 amaanansariz8882

05-01-2021

Step-by-step explanation:

ttgiffkydfhigdfgkfee FM 8

Answer Link

Otras preguntas

The x coordinate is found on the x axis which flows (vertically, horizontally) ______.

volume and formula question! use the image attached below to help me The prism shown has a volume 35cm3 Work out h,the height of the triangular cross section vo

Solve the triangle. A = 48°, a = 32, b = 27 A) Cannot be solved B) B = 38.8°, C = 113.2°, c ≈ 34.4 C) B = 38.8°, C = 93.2°, c ≈ 43 D) B = 38.8°, C = 9

Use the following corporate bond quote information to answer the questions that follow. Since this is a corporate bond, assume the company makes semi-annual cou

example of public speech

What is the correlation for the data

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

A rectangle has a height of 5y^3 and a width of 3y^3-8y^2+2y. Express the area of the entire rectangle. Your answer should be a polynomial in standard form.

need help on number 4

It is believed that the early settlers of the Pacific Islands originally migrated from __________. A. Europe B. Australia C. Southeast Asia D. Central Asia