zapperlink101
zapperlink101
02-03-2021
Mathematics
contestada
Quick please
-4 + x = 3
Respuesta :
eharding05
eharding05
02-03-2021
The answer would be x= 7
Answer Link
VER TODAS LAS RESPUESTAS ( 19+ )
Otras preguntas
hi help I've been trying to solve this for an hour and this is due in 10 minutes I just really need the correct answer please help
4. Which is the best first step to write 2(x-4)^2-3=8 in standard form?A. Factor.B. Clear the parentheses.C. Set the function equal to 0.D. Combine like terms.
What is the perimeter of the figure below?34 mm40 mm88 mm96 mmI probably doing
3. Marisol made 12 cups of party mix. She gave 3 cups to her mother and 3 cups to her grandmother. How much party mix did Marisol have left for herself? 3 cups
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.
The rumble feature on a video game controller is driven by a device that turns electrical energy into mechanical energy. This device is best referred to as __
Graph for 6x - 2y > -11
Question 17 of 30Which of the following is the energy of atoms vibrating inside an object?A. RadiantB. ElectricC. ThermalD. MechanicalSUBMIT
An owl is sitting on top of a tree that is 200 feet high. A mouse holding a cheese spots the owl on top of the tree at an angle of elevation of 32”. How far mus
Elena is organizing her craft supplies. She estimatesthat her jars will fit 1,000 buttons or 50 large beads.They actually fit 677 buttons or 22 large beads. Doe
