raceevelinemajen raceevelinemajen

02-12-2016
Biology

contestada

Where does glycolysis take place in a cell?

A. Nucleus
B. Mitochondrion
C. Cytoplasm
D. Cell membrane

Respuesta :

saleeng saleeng

16-11-2018

Glycolysis takes place in cytoplasm whereas krebs cycle occurs in mitochondria

Answer Link

Otras preguntas

A rectangular garden is 9 feet long and 3 feet wide. A second rectangular garden has dimensions that are triple the dimensions of the first garden. What is the

Firms can use one, no more than two, of five entry modes to enter into international markets. Exporting, Licensing, Strategic Alliances, Acquisitions, and newly

Sequence the skeletal and muscular changes that take place when a person inhales

What is the difference in elevation between a plane flying at 25,500 ft above sea level and a submarine traveling 450 ft below sea level?

Differences between body composition- risk for heart disease or chronic disease.

If you take in fewer calories than you need you have a what energy balance

Help! Exponential Equation WITHOUT CALCULATOR

Three students are chosen from 6 males and 4 females how many ways are there for mary to go on the trip

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Write a compound inequality that the graph could represent.