hehe6969696969 hehe6969696969

02-06-2021
Mathematics

contestada

Solve for 2. Round to the nearest tenth, if necessary.

Solve for 2 Round to the nearest tenth if necessary class=

Respuesta :

JasonAlati40 JasonAlati40

02-06-2021

Answer: the answer is 51.41281

Step-by-step explanation:

Sin=opp/hyp. sin(40)=x/69. x=69sin(40). x=51.41281

Answer Link

Otras preguntas

What is sound energy? Give two examples.

What's the difference between biotic and abiotic?

The territorial capital of Florida in 1824 was Pensacola. True False

How is a condominium diffrent than a single-family dwelling?

QuestioITU "Flattening the curve" through socially distancing prevents the overwhelming of and thus reduces avoidable deaths due to coronavirus.

1. Explain why you chose the two-word names for each organism.

Dimensions of a house are 300 feet by 125 feet. If 1 inch represents 50 feet, what are the dimensions of the house on the drawing?

Zhang Li solves the equation below by first squaring both sides of the equation. -4=\sqrt{5z+7}−4= 5z+7 minus, 4, equals, square root of, 5, z, plus, 7, end s

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Compare and contrast Benvolio and Mercutio.