aryannanicholson6 aryannanicholson6
  • 03-10-2021
  • Mathematics
contestada

Write the sum of seven and the product of fifteen and a number as an equation

Respuesta :

Heather
Heather Heather
  • 03-10-2021

Answer:

7 + 15x

Step-by-step explanation:

given: sum of seven and the product of fifteen and a number

sum of seven: 7 +

the product of fifteen: 15 ·

a number: x, n, etc

Putting it together: 7 + 15 · x

Simplfiying: 7 + 15x

Hope this helps, have a nice day! :D

Answer Link

Otras preguntas

Susan ........ (Run) to school because she was late.
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
what are 2 points on the graph for 6x-5y=25
What was religion like in Shang China?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y