r6ndomgirl
r6ndomgirl r6ndomgirl
  • 01-12-2021
  • Biology
contestada

What would happen if dogs couldn't hear?

Respuesta :

biomj biomj
  • 31-01-2022
Their other senses, such as sight, would likely increase, since they would depend on them more often.
Answer Link

Otras preguntas

Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
The Panama Canal connects what two bodies of water?
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
what are 2 examples of ionic compound?
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n