T0iffleetakar T0iffleetakar
  • 03-02-2017
  • History
contestada

Did franklin d roosevelt have polio

Respuesta :

laurenosborn
laurenosborn laurenosborn
  • 03-02-2017
yes he was diagnosed with infantile paralysis, also known as polio in 1921 at the age of 39

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
Give a recursive algorithm for finding the sum of the first n odd positive integers.
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
what is the geometric mean between 6 and 20?