isaiahcintron9oqs2yq isaiahcintron9oqs2yq

04-06-2017
English

contestada

In your own words, why is using an outline to take notes a good strategy?

Respuesta :

1candycane4u 1candycane4u

05-06-2017

It helps organize your ideas.

Answer Link

Otras preguntas

During the germinal period of prenatal development, some cells become part of the brain, some become part of the leg, and some become part of the stomach, etc.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Please help with geometry!!!

Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged

Given that A=xy find the percentage increase in A when both X and Y increase by 10%

When a circular pizza is cut into six slices using diameters, the total length of the cuts is 18 cm. what is the area of the pizza in square centimeters?

what does a light year measure

The introduction of the Green Revolution in India was intended to

The sum of two numbers is 69. The larger number is three less than twice the smaller number. Find the numbers. Show your work.

The number of students in the book club is increasing at a rate of 15% per year. In 2010 there were 9 students in the book club. Find the number of students exp