gmcgjCgxghftg5386 gmcgjCgxghftg5386

02-11-2017
Mathematics

contestada

What is the sum of all the odd positive integers less than 100?

Respuesta :

catybear2102 catybear2102

03-11-2017

2580 just add 1+3+5+7+9...91+93+95+97+99

Answer Link

Otras preguntas

Which is the chief reason English Puritans settled in North America during the 17th century?

Which of the following sentences is a clear thesis statement that supports the main idea of "Growing Up: Key Moments? A) The first time you make a big decision

Somebody help me so I can give y’all some points

The expression 10 – 8 is the amount by which 10 exceeds 8. 8 exceeds 2. 10 is less than 8. 8 is less than 2.

PLEASE HELP I NEED EXAMPLES GIVING POINTS :)) !! Write one full descriptive paragraph about this image.

the american heart association recommends strength training how many days per week for healthy adults and may low-risk cardiac patients?

How to determine the correct price of food during purchasing? ________________ ______________________________________________________________________________ __

Translate point G located at(-4,0) +5 in the x-direction and -3 in the y-direction

Why does Doodle begin to cry?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'