balbright3836 balbright3836

04-01-2018
Mathematics

contestada

How to work out 5-(-11) modulus equations?

Respuesta :

athenapadme1 athenapadme1

05-01-2018

ANSWER: 16.

A negative cancels out another negative. Therefore 5+11=16

Answer Link

Otras preguntas

What is the pianist and the weary blues doing when he makes the piano moan with Melody

what does the liver do in the excretory system

In a class of 7, there are 3 students who have done their homework. If the teacher chooses 3 students, what is the probability that none of the three students h

please help if you know, thanks!

If the points (-2, 2), (-4, 4), (2, -2), and (4, -4) are joined to form a straight line, at what point does the line intersect the y-axis

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36

What is one key difference between the radiation and convection zones?

Solve for x. Assume that lines which appear tangent are tangent.