monicacollins
monicacollins monicacollins
  • 01-03-2018
  • Mathematics
contestada

On average how many words can 400 turtles type in 400 minutes?

On average how many words can 400 turtles type in 400 minutes class=

Respuesta :

Lunarwolf
Lunarwolf Lunarwolf
  • 01-03-2018
I think the answer would be 4000. Since everything else i half of the original equasion. I don't normaly answer math question but I saw the problem and needed to know why this existed. Hope this helps. (Wait can turtles even type... Or read?)
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
what is the lcd of 10/11,29/44
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
What are the factors of 6x + 24?
what was paul revere failures
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.