usheheDHEh usheheDHEh
  • 04-03-2018
  • Social Studies
contestada

Do sections 1 and 19 introduce or ban slavery from the new territories in the Kansas Nebraska act

Respuesta :

MsEleanor
MsEleanor MsEleanor
  • 15-03-2018
Introduces slavery as an option.

The Kansas-Nebraska Act gets rid of the Compromise of 1850 and allows these two territories to vote on slavery. this is called popular sovereignty. Each territory was given a chance to vote whether or not the territory would have slavery as an option. 
Answer Link

Otras preguntas

Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
Please help me with this two step math problem! THANK YOU !!!!!!!!
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
What Role Does the Sun Play in Producing Winds And Ocean Currents
why did Mr Collins come to the Bennet family looking for a wife?
Round 46.895 to the nearest tenth
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5